Assets

About 6 results

Pfizer is the owner or exclusive licensee of certain proprietary technology and intellectual property rights relating to immunomodulatory CpG-motif-containing oligodeoxynucleotides originally developed by Coley Pharmaceutical Group. One such molecule, which is suitable for human vaccine applications as an adjuvant, is known as CpG10104 (TCGTCGTTTCGTCGTTTTGTCGTT, all linkages phosphorothioate); its compositions, methods of making and uses thereof are claimed in the provided patents and applications, either specifically or broadly. The origin of the series containing CpG10104 was the oligodeoxynucleotide (ODN) CpG7909. In vitro: The optimal concentrations of ODN to use varies depending on the cell type (i.e. human PBMC, murine splenocytes), the culture conditions as well as the read-out. However, in general, a range of ODN concentrations (ranging from 0.1 to 10 mcg/mL or 0.015 to 2 mcM) as well as time kinetics should be tested to determine optimal concentrations of ODNs and stimulation time to be used for desired read-out. Nonspecific effects of non-CpG control oligos are likely to be seen at higher ODN concentrations (1 mcg/mL and above), especially in B cell stimulation assays, less so in assays for IFN-alpha production or other assays for Th1-specific effects. In vivo: Can be used as sole adjuvant but best combined with aluminum hydroxide (e.g., Alhydrogel). Optimal dose depends on inherent immunogenicity of antigen as well as species; typcial ranges are: mouse (10-100 mcg), rat (50-250 mcg), NHP and human (0.25-1.0 mg). In vivo adjuvant activity with model antigens in mice shows enhancement of Ab titer, avidity and kinetics, and enhanced CD8 T cell responses. In vitro immune activation of mouse splenocyies or human PBMC. For in vitro or in vivo PK/PD, read-outs may include proliferation, FACS for surface markers or cytokine production, ELISA or Luminex for cytokine secretion. Solubility is up to 80 mg/mL but ODN solutions are typically 10 or 20 mg/mL Lyophilized material is stored at -20C or below until use and expected to be stable for at least several years. Liquid ODN can be re-suspended in sterile endotoxin free Tris EDTA buffer (pH 8.0; "TE") at concentrations of 10 - 80 mg/ml to serve as a stock solution but best to aliquot to avoid repeat freeze-thaws. ODN also can be resuspended in virtually any other buffered solution, or water. Long-term storage in water is not suggested, as the lack of buffer can lead to the solution becoming acidic. ODN stock solutions are stable when stored at 4C for at least 2 years under sterile, nuclease free conditions.

Moxidectin (cydectin) is a milbemycin class drug used as an antiparasiticide in animals.

Selamectin is the active in the product, Revolution. Revolution is a topical antiparasitic endo/ecto-parasites for companion animals dog/cat .

Dectomax is an injectable and pour-on antiparasitic for livestock. Doramectin (Dectomax) is a commercial antiparasitic for livestock.

Cestex (espirantel) is an oral medication for animals (dog/cat)for the treatment of helminthes. In animals, target organ is intestine. Observed activity may interfere with calcium metabolism leading to detachment and disruption of tegument.

Provided are patents and patent applications relating to a nucleic acid construct useful for expressing a vaccine antigen. The technology may have application in vaccines for various indications.